| Basic information from miRBase |
| hairpin accession number: MI0008766 |
| Located between position 30669449 and 30669544 on chromosome 7 strand + |
| Overlapping with sense strand of (intron 2). |
| (Ensemble: ENSPTRT00000035190) |
| mature miRNAs for MI0008766: |
| ptr-miR-550 (MIMAT0008230): AGTGCCTGAGGGAGTAAGAGCCC |
| You can find this miRNA in ENTREZGENE: MIR550-2 (accession: 100316529) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |