| Basic information from miRBase |
| hairpin accession number: MI0008767 |
| Located between position 33100620 and 33100715 on chromosome 7 strand + |
| Overlapping with sense strand of (intron 10). |
| (Ensemble: ENSPTRT00000035231) |
| mature miRNAs for MI0008767: |
| ptr-miR-550 (MIMAT0008230): AGTGCCTGAGGGAGTAAGAGCCC |
| You can find this miRNA in ENTREZGENE: MIR550-3 (accession: 100316393) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |