miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0004680

Located between position 87767944 and 87768029 on chromosome 4 strand +

Overlapping with sense strand of RP23-300P20.4-001 (intron 2).

(Ensemble: OTTMUST00000026608)

mature miRNAs for MI0004680:

mmu-miR-491 (MIMAT0003486): AGTGGGGAACCCTTCCATGAGG

mmu-miR-491* (MIMAT0017255): CTTATGCAAGATTCCCTTCTAC

You can find this miRNA in MGI: Mir491 (accession: 3629651)

References

[1]Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I, Nucleic Acids Res. 34:1765-1771(2006)., "The expression profile of microRNAs in mouse embryos"

[2]Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A, Mol Hum Reprod. 16:463-471(2010)., "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"

[3]Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP, Genes Dev. 24:992-1009(2010)., "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"