| Basic information from miRBase |
| hairpin accession number: MI0002547 |
| Located between position 69777019 and 69777118 on chromosome 16 strand + |
| Overlapping with sense strand of XM_511070.2 (intron 15). |
| (Ensemble: ENSPTRT00000045375) |
| mature miRNAs for MI0002547: |
| ptr-miR-140 (MIMAT0002255): AGTGGTTTTACCCTATGGTAG |
| You can find this miRNA in EMBL: AY865885 (accession: AY865885) |
| References |
| [1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes" |