| Basic information from miRBase |
| hairpin accession number: MI0007512 |
| Located between position 2251403 and 2251505 on chromosome 15 strand + |
| mature miRNAs for MI0007512: |
| gga-miR-1769* (MIMAT0007677): CTTCAGGCTTTTCTCACACCTG |
| gga-miR-1769 (MIMAT0007678): AGTGTGAAATCTGCCTGAAAGTC |
| You can find this miRNA in ENTREZGENE: MIR1769 (accession: 100315993) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |