| Basic information from miRBase |
| hairpin accession number: MI0008784 |
| Located between position 176309161 and 176309255 on chromosome 3 strand - |
| Overlapping with sense strand of XM_001164598.1 (intron 19). |
| (Ensemble: ENSPTRT00000029130) |
| mature miRNAs for MI0008784: |
| ptr-miR-569 (MIMAT0008247): AGTTAATGAATCCTGGAAAGT |
| You can find this miRNA in ENTREZGENE: MIR569 (accession: 100316348) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |