| Basic information from miRBase |
| hairpin accession number: MI0014073 |
| Located between position 10420538 and 10420624 on chromosome 2 strand + |
| Overlapping with sense strand of Sfmbt2-001 (intron 10). |
| (Ensemble: OTTMUST00000026263) |
| mature miRNAs for MI0014073: |
| mmu-miR-669a-5p (MIMAT0003477): AGTTGTGTGTGCATGTTCATGTCT |
| mmu-miR-669a-3p (MIMAT0017243): ACATAACATACACACACACGTAT |
| You can find this miRNA in ENTREZGENE: Mir669a-10 (accession: 100526494) |
| References |
| [1]Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP, Genes Dev. 24:992-1009(2010)., "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" |