miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0014077
Located between position 10425418 and 10425504 on chromosome 2 strand +
Overlapping with sense strand of Sfmbt2-001 (intron 10).
(Ensemble: OTTMUST00000026263)
mature miRNAs for MI0014077:
         mmu-miR-669a-5p (MIMAT0003477): AGTTGTGTGTGCATGTTCATGTCT
         mmu-miR-669a-3p (MIMAT0017243): ACATAACATACACACACACGTAT
You can find this miRNA in ENTREZGENE: Mir669a-12 (accession: 100526496)

References
[1]Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP, Genes Dev. 24:992-1009(2010)., "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"