miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0011910
Located between position 36851600 and 36851658 on chromosome MtChr4 strand +
mature miRNAs for MI0011910:
         mtr-miR2629a (MIMAT0013363): AGTTTTCCTCGGTAGTTAACT

References
[1]Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M, Plant Cell. 21:2780-2796(2009)., "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules"