| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0005837 |
| Located between position 174205 and 174302 on chromosome X strand - |
| Overlapping with antisense strand of CG3777-RB (intron 1). |
| (Ensemble: FBtr0070066) (FlyBase: FlyBase) |
| mature miRNAs for MI0005837: |
| dme-miR-980-5p (MIMAT0020877): AGTTTTTCATTTGGCCTGGCTAGC |
| dme-miR-980-3p (MIMAT0005496): TAGCTGCCTTGTGAAGGGCTTA |
| References |
| [1]Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC, Genome Res. 17:1850-1864(2007)., "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" |
| [2]Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M, Genome Res. 17:1865-1879(2007)., "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" |
| more data |
| Data from CoGemiR |