| Basic information from miRBase |
| hairpin accession number: MI0012656 |
| Located between position 161511731 and 161511807 on chromosome 1 strand - |
| Overlapping with sense strand of MYH7_HORSE (intron 30). |
| (Ensemble: ENSECAT00000023469) |
| mature miRNAs for MI0012656: |
| eca-miR-208b (MIMAT0012900): ATAAGACGAACAAAAGGTTTGT |
| You can find this miRNA in ENTREZGENE: MIR208B (accession: 100314779) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |