| Basic information from miRBase |
| hairpin accession number: MI0008578 |
| Located between position 22375973 and 22376048 on chromosome 14 strand - |
| Overlapping with sense strand of (intron 24). |
| (Ensemble: ENSPTRT00000047342) |
| mature miRNAs for MI0008578: |
| ptr-miR-208b (MIMAT0008068): ATAAGACGAACAAAAGGTTTGT |
| You can find this miRNA in ENTREZGENE: MIR208B (accession: 100316120) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |