| Basic information from miRBase |
| hairpin accession number: MI0012655 |
| Located between position 161483496 and 161483578 on chromosome 1 strand - |
| Overlapping with sense strand of Q2XQE4_HORSE (intron 28). |
| (Ensemble: ENSECAT00000022901) |
| mature miRNAs for MI0012655: |
| eca-miR-208a (MIMAT0012899): ATAAGACGAGCAAAAAGCTTGT |
| You can find this miRNA in ENTREZGENE: MIR208A (accession: 100315036) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |