| Basic information from miRBase |
| hairpin accession number: MI0008577 |
| Located between position 22347315 and 22347384 on chromosome 14 strand - |
| Overlapping with sense strand of (intron 26). |
| (Ensemble: ENSPTRT00000042908) |
| mature miRNAs for MI0008577: |
| ptr-miR-208a (MIMAT0008067): ATAAGACGAGCAAAAAGCTTGT |
| You can find this miRNA in ENTREZGENE: MIR208A (accession: 100316119) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |