| more data |
| Expression data from dbDEMC |
| Basic information from miRBase |
| hairpin accession number: MI0016684 |
| Located between position 73438384 and 73438453 on chromosome X strand + |
| Overlapping with antisense strand of MIR374B-201 (exon 1). |
| (Ensemble: ENST00000390738) |
| mature miRNAs for MI0016684: |
| hsa-miR-374c (MIMAT0018443): ATAATACAACCTGCTAAGTGCT |
| You can find this miRNA in ENTREZGENE: MIR374C (accession: 100500807) |
| References |
| [1]Witten D, Tibshirani R, Gu SG, Fire A, Lui WO, BMC Biol. 8:58(2010)., "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" |
| more data |
| Expression data from dbDEMC |