| Basic information from miRBase |
| hairpin accession number: MI0004772 |
| Located between position 26987154 and 26987236 on chromosome 24 strand + |
| Overlapping with sense strand of si:ch211-174k6.1-001 (intron 3). |
| (Ensemble: OTTDART00000044624) |
| mature miRNAs for MI0004772: |
| dre-miR-728 (MIMAT0003757): ATACTAAGTACACTACGTTTTC |
| You can find this miRNA in ENTREZGENE: mir728 (accession: 100033739) |
| References |
| [1]Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH, Nucleic Acids Res. 34:2558-2569(2006)., "Cloning and expression of new microRNAs from zebrafish" |