| Basic information from miRBase |
| hairpin accession number: MI0002179 |
| Located between position 26237185 and 26237262 on chromosome 14 strand - |
| mature miRNAs for MI0002179: |
| dre-miR-458 (MIMAT0001885): ATAGCTCTTTGAATGGTACTGC |
| You can find this miRNA in ENTREZGENE: mir458 (accession: 100033528) |
| References |
| [1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |