| Basic information from miRBase |
| hairpin accession number: MI0012960 |
| Located between position 55435984 and 55436055 on chromosome X strand - |
| mature miRNAs for MI0012960: |
| eca-miR-374b (MIMAT0013214): ATATAATACAACCTGCTAAGTG |
| You can find this miRNA in ENTREZGENE: MIR374B (accession: 100315029) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |