| Basic information from miRBase |
| hairpin accession number: MI0008644 |
| Located between position 73579477 and 73579547 on chromosome X strand - |
| mature miRNAs for MI0008644: |
| ptr-miR-374b (MIMAT0008124): ATATAATACAACCTGCTAAGTG |
| You can find this miRNA in ENTREZGENE: MIR374B (accession: 100316155) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |