miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0012325
Located between position 149686 and 149763 on chromosome nscaf3060 strand +
mature miRNAs for MI0012325:
         bmo-miR-2769 (MIMAT0013650): ATATATTATCAGATTTTCGGTC

References
[1]Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q, BMC Genomics. 11:148(2010)., "MicroRNAs of Bombyx mori identified by Solexa sequencing"