| Basic information from miRBase |
| hairpin accession number: MI0008774 |
| Located between position 141556384 and 141556477 on chromosome 1 strand + |
| Overlapping with sense strand of XR_024316.1 (intron 5). |
| (Ensemble: ENSPTRT00000002910) RefSeq_dna: RefSeq) |
| mature miRNAs for MI0008774: |
| ptr-miR-556 (MIMAT0008237): ATATTACCATTAGCTCATCTTT |
| You can find this miRNA in ENTREZGENE: MIR556 (accession: 100316394) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |