| Basic information from miRBase |
| hairpin accession number: MI0007725 |
| Located between position 164345705 and 164345773 on chromosome 7 strand + |
| mature miRNAs for MI0007725: |
| mml-miR-377 (MIMAT0006306): ATCACACAAAGGCAACTTTTGT |
| You can find this miRNA in ENTREZGENE: MIR377 (accession: 100315530) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |