Basic information from miRBase |
hairpin accession number: MI0008650 |
Located between position 101493625 and 101493692 on chromosome 14 strand + |
mature miRNAs for MI0008650: |
ptr-miR-377 (MIMAT0008129): ATCACACAAAGGCAACTTTTGT |
You can find this miRNA in ENTREZGENE: MIR377 (accession: 100316158) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |