miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008650
Located between position 101493625 and 101493692 on chromosome 14 strand +
mature miRNAs for MI0008650:
         ptr-miR-377 (MIMAT0008129): ATCACACAAAGGCAACTTTTGT
You can find this miRNA in ENTREZGENE: MIR377 (accession: 100316158)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"