| Basic information from miRBase |
| hairpin accession number: MI0002499 |
| Located between position 94275264 and 94275360 on chromosome 9 strand + |
| Overlapping with sense strand of (intron 15). |
| (Ensemble: ENSPTRT00000039097) |
| mature miRNAs for MI0002499: |
| ptr-miR-23b (MIMAT0002210): ATCACATTGCCAGGGATTACCAC |
| You can find this miRNA in EMBL: AY865837 (accession: AY865837) |
| References |
| [1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes" |