| Basic information from miRBase |
| hairpin accession number: MI0012902 |
| Located between position 42745895 and 42746018 on chromosome 24 strand + |
| Overlapping with antisense strand of LOC100056048 (exon 1). |
| (Ensemble: ENSECAT00000005871) |
| mature miRNAs for MI0012902: |
| eca-miR-433 (MIMAT0013158): ATCATGATGGGCTCCTCGGTGT |
| You can find this miRNA in ENTREZGENE: MIR433 (accession: 100314912) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |