| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0005842 |
| Located between position 4262679 and 4262768 on chromosome X strand - |
| Overlapping with antisense strand of CG3626-RA (intron 1). |
| (Ensemble: FBtr0070652) (FlyBase: FlyBase) |
| mature miRNAs for MI0005842: |
| dme-miR-984-5p (MIMAT0005500): TGAGGTAAATACGGTTGGAATTT |
| dme-miR-984-3p (MIMAT0020881): ATCCAACCGAATTTGGCTCG |
| References |
| [1]Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC, Genome Res. 17:1850-1864(2007)., "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" |
| more data |
| Data from CoGemiR |