| Basic information from miRBase |
| hairpin accession number: MI0007933 |
| Located between position 146446870 and 146446955 on chromosome 8 strand - |
| Overlapping with sense strand of (exon 7). |
| (Ensemble: ENSMMUT00000019030) |
| mature miRNAs for MI0007933: |
| mml-miR-937 (MIMAT0006538): ATCCGCACTCTGACTCTCCACC |
| You can find this miRNA in ENTREZGENE: MIR937 (accession: 100315591) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |