| Basic information from miRBase |
| hairpin accession number: MI0008884 |
| Located between position 143802965 and 143803049 on chromosome 8 strand - |
| Overlapping with sense strand of (exon 10). |
| (Ensemble: ENSPTRT00000038221) |
| mature miRNAs for MI0008884: |
| ptr-miR-937 (MIMAT0008344): ATCCGCGCTCTGACTCTCTGCC |
| You can find this miRNA in ENTREZGENE: MIR937 (accession: 100316284) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |