| Basic information from miRBase |
| hairpin accession number: MI0015739 |
| Located between position 1437629 and 1437707 on chromosome 8q strand - |
| mature miRNAs for MI0015739: |
| cin-miR-4183-5p (MIMAT0016798): AGCGGGAAGGAGTGGCCGGT |
| cin-miR-4183-3p (MIMAT0016799): ATCCGTGATCGCTTTGCCCGGC |
| You can find this miRNA in ENTREZGENE: mir4183 (accession: 100498996) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |