| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0005863 |
| Located between position 23468188 and 23468277 on chromosome 3R strand - |
| Overlapping with sense strand of tau-RA (intron 6). |
| (Ensemble: FBtr0085197) (FlyBase: FlyBase) |
| mature miRNAs for MI0005863: |
| dme-miR-1001-5p (MIMAT0005521): TGGGTAAACTCCCAAGGATCA |
| dme-miR-1001-3p (MIMAT0020901): ATCCTTGGGTTTCTGCTCTCGG |
| References |
| [1]Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC, Genome Res. 17:1850-1864(2007)., "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" |
| more data |
| Data from CoGemiR |