| Basic information from miRBase |
| hairpin accession number: MI0011292 |
| Located between position 3412145 and 3412251 on chromosome 3L strand - |
| Overlapping with sense strand of sty-RB (intron 1). |
| (Ensemble: FBtr0073146) (FlyBase: FlyBase) |
| mature miRNAs for MI0011292: |
| dme-miR-2282-3p (MIMAT0011790): ATCGGTGAGCTAAAAATAGAAT |
| References |
| [1]Lau NC, Robine N, Martin R, Chung WJ, Niki Y, Berezikov E, Lai EC, Genome Res. 19:1776-1785(2009)., "Abundant primary piRNAs, endo-siRNAs, and microRNAs in a Drosophila ovary cell line" |