| Basic information from miRBase |
| hairpin accession number: MI0015386 |
| Located between position 20438961 and 20439044 on chromosome Un_random strand + |
| Overlapping with sense strand of (3UTR 2). |
| (Ensemble: ENSGALT00000015673) |
| mature miRNAs for MI0015386: |
| gga-miR-3533 (MIMAT0016384): ATGAAGTGTGATGTGGATAT |
| You can find this miRNA in ENTREZGENE: MIR3533 (accession: 100498691) |
| References |
| [1]Wang Y, Brahmakshatriya V, Zhu H, Lupiani B, Reddy SM, Yoon BJ, Gunaratne PH, Kim JH, Chen R, Wang J, Zhou H, BMC Genomics. 10:512(2009)., "Identification of differentially expressed miRNAs in chicken lung and trachea with avian influenza virus infection by a deep sequencing approach" |