| Basic information from miRBase |
| hairpin accession number: MI0009920 |
| Located between position 92625530 and 92625648 on chromosome 10 strand + |
| Overlapping with sense strand of Cdk17-201 (intron 1). |
| (Ensemble: ENSMUST00000069965) |
| mature miRNAs for MI0009920: |
| mmu-miR-1931 (MIMAT0009394): ATGCAAGGGCTGGTGCGATGGC |
| You can find this miRNA in MGI: Mir1931 (accession: 3836967) |
| References |
| [1]Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK, Genome Res. 18:1787-1797(2008)., "In-depth characterization of the microRNA transcriptome in a leukemia progression model" |