| Basic information from miRBase |
| hairpin accession number: MI0012659 |
| Located between position 135627745 and 135627839 on chromosome 1 strand + |
| Overlapping with sense strand of LOC100069165 (intron 5). |
| (Ensemble: ENSECAT00000018237) |
| mature miRNAs for MI0012659: |
| eca-miR-628a (MIMAT0012903): ATGCTGACATATTTACTAGAGG |
| You can find this miRNA in ENTREZGENE: MIR628A (accession: 100314781) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |