| Basic information from miRBase |
| hairpin accession number: MI0008783 |
| Located between position 118535951 and 118536044 on chromosome 3 strand - |
| mature miRNAs for MI0008783: |
| ptr-miR-568 (MIMAT0008246): ATGTATAAATGTATACACAC |
| You can find this miRNA in ENTREZGENE: MIR568 (accession: 100316546) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |