| Basic information from miRBase |
| hairpin accession number: MI0018041 |
| Located between position 44878620 and 44878697 on chromosome 2 strand - |
| Overlapping with sense strand of Zeb2-008 (exon 3). |
| (Ensemble: OTTMUST00000029417) |
| mature miRNAs for MI0018041: |
| mmu-miR-5129 (MIMAT0020640): ATGTGGGGGCATTGGTATTTTC |
| References |
| [1]Spierings DC, McGoldrick D, Hamilton-Easton AM, Neale G, Murchison EP, Hannon GJ, Green DR, Withoff S, Blood. [Epub prior to print](2011)., "Ordered progression of stage specific miRNA profiles in the mouse B2 B cell lineage" |