| Basic information from miRBase |
| hairpin accession number: MI0012868 |
| Located between position 5343865 and 5343940 on chromosome 23 strand + |
| Overlapping with antisense strand of NTRK2 (intron 11). |
| (Ensemble: ENSECAT00000012850) |
| mature miRNAs for MI0012868: |
| eca-miR-544b (MIMAT0013118): ATTCTGCATTTTTAACAAGTTC |
| You can find this miRNA in ENTREZGENE: MIR544B (accession: 100314893) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |