| Basic information from miRBase |
| hairpin accession number: MI0007529 |
| Located between position 7801714 and 7801822 on chromosome 14 strand + |
| Overlapping with sense strand of PM5 (intron 17). |
| (Ensemble: ENSGALT00000010888) |
| mature miRNAs for MI0007529: |
| gga-miR-1786 (MIMAT0007698): ATTCTTTTCTGCTGTGTTACT |
| You can find this miRNA in ENTREZGENE: MIR1786 (accession: 100315839) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |