| Basic information from miRBase |
| hairpin accession number: MI0008749 |
| Located between position 24854961 and 24855056 on chromosome 12 strand - |
| Overlapping with sense strand of (intron 1). |
| (Ensemble: ENSPTRT00000009512) |
| mature miRNAs for MI0008749: |
| ptr-miR-548c (MIMAT0008220): CAAAAATCTCAATTACTTTTGC |
| You can find this miRNA in ENTREZGENE: MIR548C (accession: 100316211) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |