Basic information from miRBase |
hairpin accession number: MI0008746 |
Located between position 18927198 and 18927293 on chromosome 6 strand + |
mature miRNAs for MI0008746: |
ptr-miR-548a (MIMAT0008218): CAAAACTGGCAATTACTTTTGC |
You can find this miRNA in ENTREZGENE: MIR548A-1 (accession: 100316483) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |