miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008746
Located between position 18927198 and 18927293 on chromosome 6 strand +
mature miRNAs for MI0008746:
         ptr-miR-548a (MIMAT0008218): CAAAACTGGCAATTACTTTTGC
You can find this miRNA in ENTREZGENE: MIR548A-1 (accession: 100316483)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"