| Basic information from miRBase |
| hairpin accession number: MI0008747 |
| Located between position 137575838 and 137575933 on chromosome 6 strand + |
| mature miRNAs for MI0008747: |
| ptr-miR-548a (MIMAT0008218): CAAAACTGGCAATTACTTTTGC |
| You can find this miRNA in ENTREZGENE: MIR548A-2 (accession: 100316210) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |