Basic information from miRBase |
hairpin accession number: MI0008762 |
Located between position 35351775 and 35351849 on chromosome 7 strand - |
Overlapping with sense strand of XM_001169062.1 (intron 18). |
(Ensemble: ENSPTRT00000036207) |
mature miRNAs for MI0008762: |
ptr-miR-548n (MIMAT0008227): CAAAAGTAATTGTGGATTTTGT |
You can find this miRNA in ENTREZGENE: MIR548N (accession: 100316486) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |