miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0002605
Located between position 72294754 and 72294839 on chromosome 1 strand -
Overlapping with sense strand of XM_001166886.1 (intron 8).
(Ensemble: ENSPTRT00000001629)
mature miRNAs for MI0002605:
         ptr-miR-186 (MIMAT0002304): CAAAGAATTCTCCTTTTGGGCTT
You can find this miRNA in EMBL: AY865943 (accession: AY865943)

References
[1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes"