Basic information from miRBase |
hairpin accession number: MI0002605 |
Located between position 72294754 and 72294839 on chromosome 1 strand - |
Overlapping with sense strand of XM_001166886.1 (intron 8). |
(Ensemble: ENSPTRT00000001629) |
mature miRNAs for MI0002605: |
ptr-miR-186 (MIMAT0002304): CAAAGAATTCTCCTTTTGGGCTT |
You can find this miRNA in EMBL: AY865943 (accession: AY865943) |
References |
[1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes" ![]() |