| Basic information from miRBase |
| hairpin accession number: MI0008793 |
| Located between position 19422358 and 19422431 on chromosome 5 strand - |
| mature miRNAs for MI0008793: |
| ptr-miR-583 (MIMAT0008256): CAAAGAGGAAGGTCCCATTAC |
| You can find this miRNA in ENTREZGENE: MIR583 (accession: 100316395) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |