| Basic information from miRBase |
| hairpin accession number: MI0008579 |
| Located between position 133631077 and 133631144 on chromosome X strand - |
| mature miRNAs for MI0008579: |
| ptr-miR-20b (MIMAT0008069): CAAAGTGCTCATAGTGCAGGTAG |
| You can find this miRNA in ENTREZGENE: MIR20B (accession: 100316121) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |