| Basic information from miRBase |
| hairpin accession number: MI0005050 |
| Located between position 38455775 and 38455851 on chromosome 25 strand + |
| Overlapping with sense strand of MCM7_BOVIN (intron 13). |
| (Ensemble: ENSBTAT00000003728) |
| mature miRNAs for MI0005050: |
| bta-miR-93 (MIMAT0003837): CAAAGTGCTGTTCGTGCAGGTA |
| You can find this miRNA in ENTREZGENE: MIR93 (accession: 791049) |
| References |
| [1]Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP, Physiol Genomics. 29:35-43(2007)., "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" |