miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0005050
Located between position 38455775 and 38455851 on chromosome 25 strand +
Overlapping with sense strand of MCM7_BOVIN (intron 13).
(Ensemble: ENSBTAT00000003728)
mature miRNAs for MI0005050:
         bta-miR-93 (MIMAT0003837): CAAAGTGCTGTTCGTGCAGGTA
You can find this miRNA in ENTREZGENE: MIR93 (accession: 791049)

References
[1]Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP, Physiol Genomics. 29:35-43(2007)., "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"