miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0005002

Located between position 36371742 and 36371825 on chromosome 6 strand +

Overlapping with sense strand of WU:Chrm2-002 (intron 2).

(Ensemble: OTTMUST00000094559)

mature miRNAs for MI0005002:

mmu-miR-490-5p (MIMAT0017261): CCATGGATCTCCAGGTGGGT

mmu-miR-490-3p (MIMAT0003780): CAACCTGGAGGACTCCATGCTG

You can find this miRNA in MGI: Mir490 (accession: 3629662)

References

[1]Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I, Nucleic Acids Res. 34:1765-1771(2006)., "The expression profile of microRNAs in mouse embryos"

[2]Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A, Mol Hum Reprod. 16:463-471(2010)., "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"

[3]Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP, Genes Dev. 24:992-1009(2010)., "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"