| Basic information from miRBase |
| hairpin accession number: MI0008564 |
| Located between position 50174278 and 50174368 on chromosome 3 strand - |
| mature miRNAs for MI0008564: |
| ptr-miR-191 (MIMAT0008056): CAACGGAATCCCAAAAGCAGCTG |
| You can find this miRNA in ENTREZGENE: MIR191 (accession: 100316113) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |