Basic information from miRBase |
hairpin accession number: MI0008748 |
Located between position 121081156 and 121081251 on chromosome 6 strand - |
Overlapping with sense strand of (intron 2). |
(Ensemble: ENSPTRT00000066829) |
mature miRNAs for MI0008748: |
ptr-miR-548b (MIMAT0008219): CAAGAACCTCAGTTGCTTTTGT |
You can find this miRNA in ENTREZGENE: MIR548B (accession: 100316343) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |