miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008748
Located between position 121081156 and 121081251 on chromosome 6 strand -
Overlapping with sense strand of (intron 2).
(Ensemble: ENSPTRT00000066829)
mature miRNAs for MI0008748:
         ptr-miR-548b (MIMAT0008219): CAAGAACCTCAGTTGCTTTTGT
You can find this miRNA in ENTREZGENE: MIR548B (accession: 100316343)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"