Basic information from miRBase |
hairpin accession number: MI0015529 |
Located between position 6154672 and 6154730 on chromosome 7q strand - |
mature miRNAs for MI0015529: |
cin-miR-4003b-5p (MIMAT0016469): TGAGTTGGTTATTCAATCTTGCG |
cin-miR-4003b-3p (MIMAT0016470): CAAGATTGGTAACCAACACTAA |
You can find this miRNA in ENTREZGENE: mir4003b (accession: 100498886) |
References |
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" ![]() |